Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1225-0171(Print)
ISSN : 2287-545X(Online)
Korean Journal of Applied Entomology Vol.59 No.1 pp.41-54
DOI : https://doi.org/10.5656/KSAE.2020.02.0.009

Control efficacy of BtPlus against two mosquitoes, Aedes koreicus and Culex vagans

Yonggyun Kim*, Sajjadian Minoo, Shabbir Ahmed
Department of Plant Medicals, College of Life Sciences, Andong National University, Andong 36729, Korea
Corresponding author:hosanna@anu.ac.kr
February 3, 2020 February 12, 2020 February 13, 2020

Abstract


Two mosquito species were collected in still-water near farming area in Andong, Korea. Based on morphological characters, these two mosquitoes were identified as Aedes koreicus and Culex vagans, respectively. DNA barcode analyses supported the identification. An entomopathogenic bacterium, Bacillus thuringiensis subsp. israelensis (BtI), exhibited insecticidal activities against the two mosquito species and its virulence was more potent than that of B. thuringiensis subsp. kurstaki. It has been known that the bacterial metabolites of Xenorhabdus spp. suppress insect immunity and enhance pathogenicity of B. thuringiensis. This study tested the effect of the bacterial culture broth of Xenorhabdus spp. on enhancing BtI pathogenicity. Among three Xenorhabdus spp., culture broth of X. ehlersii (Xe) was relatively effective to enhance BtI pathogenicity against both mosquito species. Indeed, organic extracts of Xe culture broth suppressed the hemocyte-spreading behavior, suggesting the presence of immunosuppressant in the culture broth. These results suggest a formulation of BtPlus by mixing BtI spore and Xe culture broth to be applied to control the two mosquito species.



한국숲모기와 줄다리집모기에 대한 비티플러스 방제 효과

김 용균*, 사 자디안 민우, 샤 비르 아메드
안동대학교 생명과학대학 식물의학과

초록


안동지역 농가 주변의 정수에서 두 종의 모기가 채집되었다. 형태적 특징을 바탕으로 이들이 한국숲모기(Aedes koreicus)와 줄다리집모기 (Culex vagans)로 각각 동정되었다. 또한, DNA 바코드 서열을 분석한 결과 이러한 동정 결과를 뒷받침하였다. 이들 모기류 유충에 대해 곤충병 원세균인 Bacillus thuringiensis subsp. israelensis (BtI)가 살충효과를 보였으며 유사한 B. thuringiensis subsp. kurstaki에 비해 우수하였다. 한편 곤충의 면역억제를 유발하여 B. thuringiensis의 병원력을 높인다고 알려진 Xenorhabdus 세균류의 배양액을 BtI에 첨가하여 이들 모기류에 대한 살충력 증가 효과 유무를 확인하였다. 분석에 이용된 3 종류의 Xenorhabdus 세균배양액 가운데 X. ehlersii (Xe)의 배양액이 비교적 다른 세균배 양액에 비해 두 종의 모기류에 대해서 BtI의 살충력을 높이는 것으로 나타났다. 이를 바탕으로 Xe 세균배양액으로부터 유기용매 추출물의 생물 활성을 분석한 결과 모기의 혈구 활착행동을 뚜렷이 억제시키는 면역억제자가 존재한다는 것을 확인하였다. 본 연구는 BtI와 Xe의 두 세균을 혼 합한 비티플러스 미생물제제가 한국숲모기와 줄다리집모기의 방제에 효과적이라는 것을 제시한다.



    모기는 파리목(Diptera), 모기과(Culicidae)로 분류되며 전 세계적으로 3,209 종이 보고되었다(Harbach, 2007). 미성숙 시 기의 유충은 수서 생활을 진행하지만 완전변태 발육을 통해 발 육된 성충은 육상 생활을 보여 모기는 생리적 다양성 및 이중 생태계 환경을 갖는 분류군이다. 알에서 부화한 유충은 물속에 있는 유기물 및 조류(algae)를 섭취하며 성장하지만 여러 종의 모기 성충은 알 발육을 위해서 동물의 피를 흡혈하게 된다. 따 라서 비록 유충이 수서 생태계의 주요한 먹이사슬의 일원을 이 루지만, 성충은 인축에 피해를 주는 해충으로 간주된다. 특히 다양한 병원성 원생동물 및 arbovirus를 매개하여 인축 질병을 일으키는 의학곤충으로 분류된다(Whitfield, 2002). 즉, 모기는 말라리아(malaria)와 사상충증(filariasis)과 같은 인체기생충 을 매개하고 황열(yellow fever), 일본뇌염(Japanese encephalitis), 뎅기열(dengue fever), 웨스트나일(west nile) 및 최근의 소두증 (microcephaly)을 유발하는 바이러스를 인체 및 가축에게 전달 한다(Kim et al., 2012). 이러한 모기는 매년 7 억명 이상의 사람 들에게 다양한 질병을 옮기고 있으며, 그 중 말라리아의 경우 매년 3 백만명 이상의 사람이 모기의 의해 전염된 병으로 사망 한다(Kang et al., 2005). 따라서 이들 전염병을 막기 위해서는 이들 병원균을 전파하는 모기류 방제가 필수적이다. 모기과는 3 개의 아과인 Anophelinae (학질모기아과), Culicinae (보통모 기아과) 그리고 Toxorhynchitinae (왕모기아과)로 세분된다. 이 가운데 왕모기아과는 흡혈활동을 하지 않기에 인체에 해를 주는 의학곤충에서 목록에 포함되지 않는다.

    학질모기아과에는 Chagasia, Bironella 그리고 Anopheles (얼룩날개모기속)의 3 속이 포함된다(Lee, 2003). 여기서 우리 나라에 삼일열말라리아를 매개하는 중국얼룩날개모기(An. sinensis)가 포함되어 말라리아 원충인 Brugia malayi를 전파하 게 된다. 보통모기아과에는 25 개 속이 존재하는 데 여기에는 의학곤충에서 크게 주목을 받는 Aedes, Culex 그리고 Ochlerotatus 속이 포함된다. 우리나라에서는 일본뇌염을 전파하는 빨 간집모기(Cx. tritaeniorhynchus), 흰줄숲모기(Ae. albopictus) 그리고 토고숲모기(Ochlerotatus togoi)가 크게 문제되고 있다.

    국내에 발생하는 밀도를 중심으로 가장 우점되는 모기 종은 금빛숲모기(Ae. vexans nipponii)로서 전체 모기 발생의 56%를 차지하며 잠재적으로 웨스트나일바이러스를 전파할 것으로 우 려하고 있다(Yeom, 2017). 다음으로 얼룩날개모기류(Anopheles spp.)로서 전체 모기 발생의 37.9%를 차지하며 삼일열말라리 아 매개체로서 방역에 관심을 두고 있다. 작은빨간집모기(Cx. tritaeniorhynchus)가 약 3.3% 발생 빈도를 보이며 일본뇌염 매 개체로서 주목받고 있다. 흰줄숲모기는 불과 0.05%의 발생 빈 도를 나타내지만 뎅기열바이러스의 매개체로서 의심되고 있다.

    모기가 매개하는 병원체는 모기의 면역반응을 극복하여야 만 척추동물 기주로 옮기게 된다. 따라서 모기 면역에 대한 이 해는 병 매개 기작을 파악하는 것은 물론이고 이를 교란하는 새 로운 모기 방제 기술을 개발하는 데 도움을 준다. 성충은 물론 이고 모기 유충도 면역반응을 보이게 되나 성충에 비해 많은 연 구가 진행되지 않았다. 이 가운데 몸 표면의 표피층에 의한 물 리적 방어 기능 및 체내 혈구세포들이 세균 감염에 따른 응집 현상 및 멜라닌 형성이 보고되었다(League and Hillyer, 2016). 여기에 유충 시기의 여러 면역 관련 인자들이 성충 시기의 면역 능력에 영향을 준다는 훈련면역(trained immunity) 과정이 이 짚트숲모기(Ae. aegypti)와 말라리아학질모기(An. gambiae)에 서 보고되었다(Moreno-García et al., 2015; Brown et al., 2019). 성충의 경우 병원균의 감염 경로에 따라 중장, 혈강 그리고 침 샘으로 침입 단계별로 나누어 이들 면역반응을 구분할 수 있다 (King, 2020). 중장의 경우 상피세포가 병원균의 혈강으로 침 입에 대비한 물리적 장벽을 주게 되며, 소화관 내강에 존재하는 항생단백질과 다양한 미생물이 병원균 성장에 대한 길항작용 을 주게 된다(Pakpour et al., 2013; Apte-Deshpande et al., 2012). 상피세포를 뚫고 침입하려는 병원균은 다시 중장세포 기저막 (basal lamina)에서 다시 혈강으로부터 오는 혈구세포 및 체액 성 면역인자의 공격을 받게 된다(Blandin et al., 2004; Kwon et al., 2017). 혈강에서는 혈구세포를 중심으로 세포성 면역반응 과 다양한 항생단백질, 멜라닌반응 및 반응성이 높은 산화물질 을 통한 화학적 면역반응이 일어나게 된다(King and Hillyer, 2012). 모기의 침샘에 도달한 병원체는 침샘세포에서 분비하는 cecropin가 같은 항생단백질, 항 바이러스성 cystatin 및 세포자 연치사 작용에 의해 억제된다(Luplertlop et al., 2011;Sim et al. 2012; Dong et al., 2016).

    모기 방제는 화학농약(pyrethroid, organophosphate, carbamate, neonicotinoid)을 이용하여 주로 성충을 대상으로 한 화학적 방 제에만 의존하여 왔다(Ahn, 2011; Kil et al., 2008). 또는 기피 제를 사용하여 모기 성충으로부터 피해를 막는 간접적 방법도 여기에 포함된다(Kang et al., 2005). 반면에 모기 유충의 경우 모기의 발생 장소가 되는 장소나 인공물을 변경 또는 제거시켜 모기의 서식지를 제거하는 물리적 방제(Kudom, 2015), 식물추 출물 또는 곤충성장조절제 사용과 같은 화학적 방제(Choi et al., 2007; Wang et al., 2016), 천적을 이용한 지속적인 유충 포 획으로 모기 유충의 밀도를 감소시키는 생물적 방제(Yu and Kim, 1989), 그리고 위에 기술한 방법들을 함께 사용하는 종합 적 방제(Lima et al., 2015)가 있다. 여기에 모기의 면역반응을 억제하여 기존의 미생물농약의 살충력을 높여주는 생물종합방 제 기술이 보고되었다(Park et al., 2016). 특히 기존의 Bacillus thuringiensis (Bt, 비티)의 곤충 혈강 침입력 및 살충력에 바탕 을 두고 여기에 면역억제 인자를 가진 Xenorhabdus 또는 Photorhabdus 세균배양액을 혼합하여 살충력을 높이려는 비 티플러스(BtPlus)가 고안되어 여러 해충에 적용되고 있다(Seo and Kim, 2011). 본 연구는 경북 안동지역에서 채집된 두 모기 류를 대상으로 비티플러스를 통해 이들 모기류의 효과적 종합 생물방제 기술을 개발하였다.

    재료 및 방법

    모기 채집

    본 연구에 사용된 모기는 경북 안동시 기느리 지역에서 2 회 (2019년 6월 12일과 7월 10일) 채집하여 얻었다. 채집 지역은 농가 인근에 약 100 L 크기의 플라스틱 용기에 담겨진 농업 용 수로서 적어도 수 개월간 방치된 장소였다. 이곳에서 상이한 종 으로 여겨지는 유충들을 약 500 마리를 채집하였다. 이들 모기 류는 본 연구를 통해 한국숲모기(Ae. koreicus)와 줄다리집모 기(Cx. vagans)로 동정되었다. 약제 실험의 대조로 실내에서 누 대 사육하는 흰줄숲모기(Ae. albopictus)가 경북대 김동흔 교수 연구실에서 분양받아 이용하였다.

    모기동정

    형태적 동정은 Lee (2003)의 분류 동정 특징을 이용하였다. 분자 동정은 cytochrome oxidase-I (CO-I) 영역을 대상으로 DNA barcode를 분석할 수 있는 프라이머를 이용하여 염기서 열을 판독하였다. 전체 게놈 DNA는 Chelex 방식(Kim and Kim, 2014)을 이용하여 추출하였다. 즉, 모기 성충 1 마리에 500 ㎕의 20% Chelex를 채우고 95℃에서 20 분간 열처리 한 후 14,000 x g에서 3 분간 원심분리한 후 상등액을 PCR에 이용 하였다. PCR 조건은 전체 반응용액이 25 ㎕를 기준으로 주형 DNA는 1 ㎕, 10x 완충용액은 2.5 ㎕, 기질 dNTP (각각 10 mM)는 2.5 ㎕, 프라이머(10 pmol/㎕)는 각각 2.5 ㎕, Taq polymerase가 1 ㎕ 그리고 탈이온증류수가 13 ㎕로 구성되었 다. CO-I 유전자 프라이머는 5'-GTAAAACGACGGCCAGG GAGGATTTGGAAATTGATTAGTTCC-3'과 5'-CAGGAA ACAGCTATGACCCCGGTAAAATTAAAATATAAACTT C-3 을 이용하였다. 각 5‘말단에 M13 범용 프라이머 서열(밑줄 친 부위)을 이용하여 염기서열 분석을 진행하였다. 염기서열 분석은 Lasergene (DNAStar, Version 6.0, Madison, WI, USA) 의 EditSeq 프로그램을 이용하였다. 이때 electropherogram을 확인하여 불량 서열을 제거하였으며 최종적으로 얻어진 서열 을 NCBI-GenBank (www.ncbi.nlm.nih.gov)의 BlastN 프로그 램을 이용하여 과실파리 종을 판별하였다. 분자계통분류는 BioEdit 7.2 프로그램을 이용하여 각 염기서열을 정렬하였으 며, MEGA 6.0 프로그램(Tamura et al., 2013)의 Neighborjoining 방법을 이용하였다.

    모기사육

    모기를 사육하는 실내조건은 온도 25±1℃, 광주기 16:8 h (L:D)이며, 상대습도 40∼60%를 유지하였다. 약 200 마리의 유충은 500 mL의 증류수가 담겨 있는 사육용기(25 × 10 × 8 cm)에 1:1로 혼합된 어분(MillepetArtemia, Ansan, Korea)과 건조효모(Samchon Chemical, Damyang, Korea)를 약 1 g의 분 량을 3 일 간격으로 공급하였다. 암수 성충에게는 10% 설탕물 을 공급하였으며, 암컷은 원교계 마우스(Mus musculus)를 이 용하여 3 일 간격으로 각각 약 4 시간 동안 흡혈하게 하였다. 흡 혈한 암컷의 산란을 유도하기 위해 10 cm 지름의 원형 용기에 증류수를 담고 이 위에 여과지를 놓아두었다. 연구 과정 동안 동물윤리에 관한 사항을 준수하였다.

    모기 혈림프 추출

    혈림프를 모으기 위해 항응고용액(98 mM NaOH, 186 mM NaCl, 17 mM Na2EDTA, 41 mM citric acid, pH 4.5) 10 μL를 슬라이드글라스에 방울 형태로 분주했다. 4령 유충을 건조된 티슈에 올려놓고 몸 표면의 물기를 제거하였다. 이 건조된 유충 을 항응고용액에 넣고 핀셋으로 복부 측면 체벽에 홈을 만들어, 스며 나오는 혈림프를 수거하였다. 동일하게 3 마리의 유충 혈 림프를 10 μL 항응고용액에 모았다.

    비티 생물농약 제조

    분석에 이용된 두 종류의 비티 균주는 Park et al. (2016) 연구 에 사용된 BtI (B. thuringiensis subsp. israelensis)와 BtK (B. thuringiensis subsp. kurstaki)였다. 이들 세균의 seed 배양을 위 해 2 mL의 TSB (tryptic soy broth, Difco, MD, USA) 배지에서 24 시간 동안 28℃에서 180 rpm의 속도로 회전진탕 배양하였 다. 이후 1 L의 TSB 배지에 배양된 비티 세균 1 mL를 접종한 후 seed 배양과 동일한 조건으로 48 시간 동안 배양하였다. 포 자형성을 유도하기 위해 정지기에 도달한 TSB 배지를 4℃에 서 48 시간 동안 저온처리를 하였다. BtI 포자 농도는 1010 spores/mL 이상이 되도록 8,000 rpm에서 30 분간 각 배양액을 원심분리과정을 통하여 상등액인 배지 성분을 제거하였으며 멸균증류수에 녹여 처리 농도에 맞추었다.

    모기 유충에 대한 약제 방제 생물검정

    약제 검정에 4령 유충이 이용되었다. 생물검정은 6-well plate (Corning, Lowell, MA, USA)를 이용하여 각 well에 5 mL 의 처리 용액을 넣고 여기에 10 마리의 유충을 투여하였다. 농 도별 비티 살충력을 분석하기 위해 0, 102, 103, 104 및 105 spores/mL의 농도로 증류수를 이용하여 조제하였다. 세 종류 의 Xenorhabdus 세균이 이전의 연구들(Park et al., 1999, 2016;Sadekuzzaman and Kim, 2017)에서 확보되었고, 이들의 배양 액이 비티 세균의 살충력 상승에 분석되었다. Xn (X. nemato phila), Xh (X. hominickii) 그리고 Xe (X. ehlersii)가 28℃에서 48 시간 동안 배양되었다. 원심분리 후 상등액에 포함된 세균은 95℃에서 1 시간 처리하여 치사시켰다. 이들 배양액의 단독 처 리는 5 mL 증류수에 0, 25, 50, 75 및 100%의 농도를 이용하였 다. 각 생물검정은 3 회 반복하였으며 각 시험구는 모기 유충 10 개체로 구성되었다. 처리된 plate는 온도 28°C, 상대습도 70% 조건에서 방치한 후 24 시간 후에 치사 개체를 조사하였다. 치 사 개체는 육안으로 관찰시 움직임이 없는 개체로 판정하였다.

    세균 이차대사산물 추출

    세균배양액에서 유래되는 이차대사산물의 추출은 Seo et al. (2012)의 방식을 따랐다. 간략하게 소개하면, Xe 세균 배양액(1 L)을 이용하여 동량의 헥산과 혼합한 후 분획깔때기를 이용하 여 유기용매층을 분리하여 헥산추출물(HEX)로 이용했다. 다 시 수용액층은 동량의 에틸아세테이트와 혼합하여 다시 유기 용매층을 분리하여 에틸아세테이트 추출물(EAX)로 이용했다. 이와 같은 방식으로 차례로 클로로포름 추출물(CX) 및 부탄올 추출물(BX)을 모았다. 이상의 유기용매 추출물은 모두 회전진 공증발기(Sunil Eyela, Seognam, Republic of Korea)를 이용하 여 농축한 후 5 mL의 메탄올로 녹여 실험에 이용하였다.

    혈구 활착 행동 분석

    앞에서 기술한 바와 같이 혈림프를 얻은 후 이를 원심분리 (1,000 x g, 3 분)한 후 혈구를 모았다. 혈구 침전물에 다시 200 μ L의 항응고용액을 넣어 현탁액을 만든 후 얼음에 40 분간 반응 시켰다. 이후 다시 원심분리하여 상등액 150 μL를 제거한 후 곤 충 세포 배양액인 TC100 (Welgene, Daegu, Korea)로 100 μL를 채워 넣었다. 각 혈구행동 분석 반응용액(50 μL)은 48 μL의 혈 구현탁액에 세균배양액 유기용매 추출물을 2 μL을 부가한 후 혈구 활착 정도를 관찰하였다. 상온(25℃)에서 40 분간 반응 후 에 혈구의 활착을 위상차현미경(IX70, Olympus, Tokyo, Japan) 으로 400 배의 배율에서 조사하였다. 활착된 혈구세포 형태는 주로 과립혈구와 부정형혈구로서 허족(pseudopodia) 또는 돌기 (filopodia)의 성장으로 구분하였다. 각 처리는 3 반복으로 실시 되었다. 각 반복은 임의의 100 개의 혈구세포 가운데 활착된 혈 구수 비율로 산출하였다. F-actin의 성장은 Ahmed and Kim (2019)의 방식에 따라 fluorescein isothiocyanate (FITC) 형광 표식자가 붙은 phalloidin을 이용하였으며, 핵은 4′,6-diamidino -2-phenylindole (DAPI)로 염색하였다.

    통계분석

    모든 살충효과에 대한 생물검정 결과는 백분율 자료로서 arsine 변환 후 SAS PROC GLM (SAS Institute, 1989)을 이용 하여 ANOVA 분석 및 처리 평균간 비교를 실시하였다.

    결 과

    야외 모기류 채집 및 종동정

    논과 밭 그리고 주변에 숲이 존재하는 안동시 기느리 지역에 서 2019년 여름에 농가 주변에 방치된 농업용수 용기에서 다수 의 모기류 유충이 존재하는 것을 발견하였다(Fig. 1). 이들 모기 유충을 실험실로 가져와 사육한 결과 형태 동정이 가능한 성충 으로 발육하였다. 성충은 최소 두 종류로 나타났으며 이들 모두 는 앉은 자세가 학질모기아과(지면과 사선 방향)와 차이를 보 여 국내에서 비교적 많은 발생을 보이는 보통모기아과(지면과 평행)에 속하는 것으로 판단하였다. 형태 형질로 사용되는 주 둥이 및 촉수의 길이와 모양, 날개 및 기문 주위의 강모 모양 그 리고 앞다리 발톱 모양을 통해 한 종은 Culex 속에 속한 것으로 판단되었다(Fig. 2).

    여기에 복부와 다리의 띠 모양 그리고 가슴등판에 존재하는 강모 모양은 이 모기가 줄다리집모기(Cx. vagans)로 판명되었 다(Table 1). 다른 한 종도 속의 형질 및 종의 형질이 한국숲모 기(Ae. koreicus)와 유사한 것으로 판명되었다(Fig. 3, Table 2).

    줄다리집모기로 형태 동정한 결과를 뒷받침하기 위해 DNA 바코드 영역의 CO-I 유전자 서열(Fig. S1A)을 기반으로 분석 한 결과 줄다리집모기와 가장 높은 상동성(약 97.9%)을 보였다 (Fig. 4). 또한, 줄다리집모기와 유사한 모기류와 계통 분류한 결과 본 연구 대상의 줄다리집모기가 C. vagans와 함께 분지하 였다. 유사한 방식으로 한국숲모기도 CO-I 염기 서열(Fig. S1B)로 Ae. koreicus와 높은 상동성(약 99.6%)을 나타내서 형 태 동정의 결과를 뒷받침하여 주었다(Fig. 5).

    면역억제물질을 추가한 비티 미생물 약제의 모기류 방제 효과

    두 종류의 비티 세균에 대한 섭식 독성을 비교한 결과 B. thuringiensis israelensis (BtI)가 B. thuringiensis kurstaki (BtK) 에 비해 살충력이 높은 것으로 판명되었다(Fig. 6A). 중앙치사 농도(LC50)를 비교하여 보면 BtI는 196.4 (95% 신뢰구간: 121.4 ∼ 307.9) spores/mL이고, BtK는 553.5 (95% 신뢰구간: 283.1 ∼ 998.8) spores/mL로 추정되었다. 즉, BtI가 BtK에 비 해 LC50로 비교하여 보면 흰줄숲모기에서 약 2.8 배 높은 독성 을 보였다. 반면에 곤충병원세균으로 알려진 3 종류의 Xenorhabdus 세균배양액들은 이 모기 유충에 대해서 모두 효과적 섭 식 독성을 나타내지 못하였다(Fig. 6B).

    Xenorhabdus 세균배양액이 비티 살충력을 높일 수 있을지 를 분석하기 위해 이들 세균배양액을 BtI와 혼합하여 모기류에 처리하였다(Fig. 7). 여전히 이들 Xenorhabdus 세균배양액들 은 모기 유충들에게 영향을 주지 않았다. 그러나 BtI와 혼합 처 리하면 특정 모기에 대해서 특정 Xenorhabdus 종 배양액이 비 티의 살충력을 증가시켰다. X. hominickii 세균 배양액의 경우 는 흰줄숲모기와 한국숲모기에 대해서 이러한 협력 효과를 주 었다. X. ehlersii 세균 배양액은 본 연구에서 동정된 두 모기류 모두에 상승효과를 주었다. X. nematophila 배양액은 세 종류 의 모기류 전체에 대해서 BtI 살충력을 상승시키지 못하였다.

    X. erlersii 세균배양액이 모기 면역반응에 미치는 영향을 살 펴보기 위해 이 배양액을 서로 다른 유기용매로 추출하여 각 용 매별 추출물질의 혈구 활착반응 억제효과를 분석하였다(Fig. 8). 세 종류의 모기류 유충의 혈구세포가 분석되었다. 대부분 원형의 세포 모양과 세포질 내부의 과립을 지니는 과립혈구의 모습을 지니고 있었으나 일부는 일정한 방향으로 길게 활착하 는 부정형혈구의 모습도 보였다(Fig. 8A). 이들 혈구세포는 세 포내 F-actin의 형성에 따라 혈구 활착 행동을 보여주었다(Fig. 8B). 이러한 혈구 활착행동에 대해서 헥산 또는 에틸아세테이 트의 유기용매 추출분획구가 뚜렷한 억제효과를 보인 반면 클 로로포름 또는 부탄올의 추출액에서는 이러한 억제효과를 나 타내지 않았다(Fig. 8C).

    고 찰

    국내에서 모기 발생은 다양한 지역과 시기에 모니터링되었 다. 발생하는 모기류의 분류는 Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Hulecoeteomyia, Mansonia, Ochlerotatus, Stegomyia의 9 속을 포함하며 이 가운데 금빛숲모기(Ae. vexans nipponii), 중국얼룩날개모기(An. sinensis) 및 작은빨간집모기 (Cx. tritaeniorhynchus)가 우점종으로 나타나고 있다(Jeong and Lee, 2003; Kim et al., 2003;2012). 그러나 이러한 국내 모 기 발생 양상은 지역에 따라 차이를 보인다. 예를 들어, Jegal et al. (2019)은 인천 도심지역과 화성 농촌 지역에서 각각 3년간 (2016-2018) 모기를 조사한 결과 도심지역에서는 빨간집모기 (Cx. pipiens)가 92.21%로 절대 우위를 차지하는 반면, 농촌 지 역에서는 금빛숲모기가 61.90%, 다음으로 등줄숲모기(Ochlerotatus dorsalis)가 17.10%, 이어서 작은빨간집모기(1.84%) 순으로 채집되었다. 본 연구는 안동지역 농가 주변에서 두 종의 모기류를 채집하여 각각 한국숲모기와 줄다리집모기로 각각 동정하였다. 한국숲모기는 동남아시아가 원산지로서 높은 침 입력 및 정착 능력으로 현재 유럽 전역에 퍼져 있다(Marini et al., 2019). 이러한 이유는 교역량의 증가로 동남아시아에서 유 럽까지 전파가 가능하였고, 여기에 한국숲모기의 알이 저온 및 건조에 높은 내성을 보여 유사한 흰줄숲모기에 비해 더 광범위 한 지역에 서식이 가능하였다(Montarsi et al., 2013). 한국숲모 기는 바이러스 및 기생충을 매개하는 인자로 주목을 받고 있다. 예를 들어 야외에서 채집된 한국숲모기에서 뇌염바이러스 (Japanese encephalitis virus) (Miles, 1964)와 사상충(Dirofilaria repens) (Kurucz et al., 2018)이 발견되었다. 실험실 조건에서 도 한국숲모기는 chikungunya 바이러스 (Ciocchetta et al., 2018) 및 개사상충(D. immitis) (Montarsi et al., 2015)을 매개 할 수 있는 것으로 알려져 있다. 줄다리집모기는 국내에서는 비 교적 거의 모든 지역에서 서식하고 있으며 채집된 전체 모기류 가운데 2.7%의 개체 빈도를 나타내며 인체 흡혈하는 것으로 알 려져 있다(Lee et al., 1984).

    병원 미생물에 대한 곤충의 면역반응은 생존력을 높여주는 주요한 생리기작이다. 이러한 면역반응을 억제하여 병원미생 물인 비티의 살충력을 높이려 개발된 약제를 비티플러스라 명 명하였다(Seo and Kim, 2011). 다양한 비티 종류가 갖는 선택 적 해충 적용 범위를 이용하여 대상 해충을 결정하게 된다. 비 교적 Cry1 독소에 감수성인 나비목은 B. thuringiensis subsp. kurstaki (BtK) 또는 B. thuringiensis subsp. aizawai를 주요 비 티로 이용하는 반면 Cry3 독소 단백질에 감수성인 딱정벌레류 에는 B. thuringiensis subsp. tenebrionis를 이용하여 제작하게 된다(Seo et al., 2010). 반면에 본 연구에서 이용한 비티플러스 의 경우는 파리목에 살충력이 높은 Cry4 독소 단백질 기반의 B. thuringiensis subsp. israelensis (BtI)를 이용하게 된다(Park et al., 2016). 따라서 특정 비티 균주에 곤충면역저하 물질을 포함 한 Xenorhabdus 세균배양액을 혼합하여 모기에 대한 살충력을 높이기 위해 본 연구가 수행되었다. BtI가 BtK에 비해 모기류 에 대해서 높은 살충력을 보여주었다. 이러한 결과는 이전의 다 른 모기류에 대한 비티 균주 분석의 결과를 뒷받침하여 주고 있 다(Park, 2015). 곤충의 면역을 억제하는 인자들을 포함하고 있 는 Xenorhabdus 세균 균주들 가운데 3 종류가 비교 분석되었으 며, 각각 모기류에 대한 BtI의 방제 효과를 높여주었다. 이들 가 운데 X. ehlersii의 배양액은 본 연구에서 동정된 두 종류의 모 기류 모두에 대해서 BtI의 방제 효과를 높여주었다. 다시 세균 배양액을 헥산 또는 에틸아세테이트로 추출한 물질 분획구들 은 모기 혈구세포의 활착 행동을 억제하였다. X. ehlersii 에틸 아세테이트 추출물에는 oxindole을 포함한 다양한 세균 이차 대사산물이 포함되어있는 것으로 알려졌다(Park et al., 2016;Sadekuzzaman and Kim, 2017).

    본 연구에서 개발한 모기에 대한 비티플러스 약제 개발 방향 은 기존에 나비목, 딱정벌레목 및 파리목의 해충에 대해서 진행 되어 온 연구의 연장선에 있다. 즉, 비티의 Cry 독소 단백질이 대상 해충에 따라 선택적 독성을 나타내기에 대상 해충별로 특 정 Cry 독소 단백질을 생산하는 비티 균주를 선발해야 했다. 예 를 들어 배추좀나방(Plutella xylostella)의 경우는 BtK가 효과 적이지만, 파밤나방(Spodoptera exigua)의 경우는 B. thuringiensis aizawai (BtA)가 효과적이기에 이들 둘을 모두 방제하 기 위해서는 두 비티 균주에 면역억제자를 첨가한 Dual BtPlus 가 개발되어야 했다(Eom et al., 2014). 비티 균주의 Cry 독소 단백질에 의해 중장의 상피세포를 붕괴시켜주면, 이때 Xenorhabdus 또는 Photorhabdus의 세균배양액에 존재하는 면 역억제물질이 혈강으로 침투하여 대상 곤충의 면역을 억제하 게 된다(Jung and Kim, 2006). 특히 이들 세균배양액에는 아이 코사노이드(eicosanoids) 생합성에 관여하는 인지질분해효소 (phospholipase A2: PLA2)를 억제하는 이차대사산물이 다수 포 함되어 있다(Kim et al., 2018). 아이코사노이드는 곤충의 세포 성 및 체액성 면역반응을 중개하는 내분비 물질로서 다양한 외 래 병원체에 대해서 곤충 체내의 면역 신호물질로 작용하게 된 다(Stanley and Kim, 2019). 현재 8 종의 PLA2 억제 세균 대사 물질이 이들 세균류에서 밝혀졌는데 이 가운데 oxindole이 X. ehlersii 세균배양액에 존재하는 것으로 알려져 있기에 본 연구 에서 얻은 비티 상승효과는 아마도 oxidole과 다른 세균 대사물 질들이 PLA2를 억제하여 아이코사노이드 생합성을 막고 이에 따라 기주 면역저하는 비티의 살충력을 높였을 것으로 추정된다.

    이상의 결과는 Xenorhabdus 세균배양액에 포함된 이차대사 산물이 한국숲모기와 줄다리집모기에 대한 비티 살충력을 높 여주어 이들 두 세균 혼합물을 이용한 새로운 모기 방제제 개발 가능성을 열어주었다.

    사 사

    본 연구는 2019년도 안동대학교 학생교육지도비로 지원되 었다. 안동대학교 식물의학과 김효일 학부생이 야외 모기 채집 과 실내 모기 사육에 참여하였다.

    KSAE-59-1-41_F1.gif

    Field collection of mosquitoes from still water in a barren reservoir, which was located near agricultural areas in Andong, Korea. Two times collections were performed at June 10 and July 12, 2019.

    KSAE-59-1-41_F2.gif

    Morphological characters used for genus and species identification of Cx. vagans. Arrows indicate the key characters in each panel.

    KSAE-59-1-41_F3.gif

    Morphological characters used for genus and species identification of Ae. koreicus. Arrows indicate the key characters in each panel.

    KSAE-59-1-41_F4.gif

    Identification of Cx. vagans using CO-I sequence. (A) Bast analysis of CO-I sequence. (B) Phylogenetic analysis of CO-I sequence with those of other 15 species in Culex mosquitoes. Individual nodes possess bootstrap values obtained from 1,000 × repetition. GenBank accession numbers are presented before species names.

    KSAE-59-1-41_F5.gif

    Identification of Ae. koreicus using CO-I sequence. (A) Bast analysis of CO-I sequence. (B) Phylogenetic analysis of CO-I sequence with those of other 7 related mosquitoes. Individual nodes possess bootstrap values obtained from 1,000 × repetition. GenBank accession numbers are presented before species names.

    KSAE-59-1-41_F6.gif

    Bioassay of two Bt strains (B. thuringiensis israelensis (BtI) and B. thuringiensis kurstaki (BtK)) against Cx. vagans larvae. Each assay used 5 mL containing different test bacterial or culture broth concentrations. Mortality was measured at 24 h after treatment. Each replication used 10 larvae and was replicated three times. (A) Bt toxicity (B) Culture broth toxicity of three Xenorhabdus species: X. hominickii (Xh), X. ehlersii (Xe), and X. nematophila (Xn). Different letters above standard deviation bars indicate significant difference among means at Type I error = 0.05 (LSD test).

    KSAE-59-1-41_F7.gif

    Enhanced mosquitocidal activity of B. thuringiensis israelensis (BtI) by adding culture broth of three different Xenorhabdus species. Three mosquito species were used: Ae. albopictus (Aa), Cx. vagans (Cv), and Ae. koreicus (Ak). Each assay used 5 mL containing 105 BtI spores/mL (BtI alone), 10% bacterial culture broth (CB), or both (BtI+CB). Mortality was measured at 24 h after treatment. Each replication used 10 larvae and was replicated three times. Different letters above standard deviation bars in each mosquito species indicate significant difference among means at Type I error = 0.05 (LSD test).

    KSAE-59-1-41_F8.gif

    Immunosuppressive activity of X. ehlersii culture broth against mosquito hemocytes. (A) Hemocytes collected from larvae of three mosquito species. Scale bar represents 10 ㎛. (B) Hemocyte-spreading behavior of three mosquito species. Hemocytes were stained at F-actin by phalloidin labeled with FITC and observed at 400x with a fluorescence microscope. Spread hemocytes exhibit focal adhesion (FA), filopodial (FP) or lamellopodial (LP) extension. Scale bar represents 10 ㎛. (C) Inhibitory activity of organic extracts of X. ehlersii culture broth against hemocyte-spreading behavior of Cx. vagans. Four organic extracts used hexane (HEX), ethylacetate (EAX), chlorform (CX), and butanol (BX). Control used methanol solvent used for dissolving the extracts. Each replication used randomly chosen 100 hemocytes by counting hemocytes exhibiting FP or LP extension. Each treatment was replicated three times. Different letters above standard deviation bars indicate significant difference among means at Type I error = 0.05 (LSD test).

    Species identification of Culex isolate #3 using morphological characters

    Identification of Aedes isolate #2 using morphological characters

    Reference

    1. Ahmed, S. , Kim, Y. ,2019. PGE2 mediates cytoskeletal rearrangement of hemocytes via Cdc42, a small G protein, to activate actin remodeling factors in Spodoptera exigua (Lepidoptera: Noctuidae). Arch. Insect Biochem. Physiol. e21607, 1-17.
    2. Ahn, Y. ,2011. Evaluation of insecticide resistance of vector mosquitoes. Seoul National University, Seoul, Korea.
    3. Apte-Deshpande, A. , Paingankar, M. , Gokhale, M.D. , Deobagkar, D.N. ,2012. Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus. PLoS One 7, e40401.
    4. Blandin, S. , Shiao, S.-H. , Moita, L.F. , Janse, C.J. , Waters, A.P. , Kafatos, F.C. , Levashina, E.A. ,2004. Complement-like protein TEP1 is a determinant of vectorial capacity in the malaria vector Anopheles gambiae. Cell 116, 661–670
    5. Brown, L.D. , Shapiro, L.L.M. , Thompson, G.A. , Estévez-Lao, T.Y. , Hillyer, J.F. ,2019. Transstadial immune activation in a mosquito: adults that emerge from infected larvae have stronger antibacterial activity in their hemocoel yet increased susceptibility to malaria infection. Ecol. Evol. 9, 6082–6095.
    6. Choi, S.Y. , Oh, S.C. , Cho, M.S. , Paek, S.K. , Kim, J.S. , Kim, D.A. , Gill, M.R. , Youn, Y.N. , Yu, Y.M. ,2007. Bioassay of environmentfriendly insecticides for management of mosquito, Culex pipiens molestus. Korean J. Appl. Entomol. 46, 261-267.
    7. Ciocchetta, S. , Prow, N.A. , Darbro, J.M. , Frentiu, F.D. , Savino, S. , Montarsi, F. , Capelli, G. , Aaskov, J.G. , Devine, G.J. ,2018. The new European invader Aedes (Finlaya) koreicus: a potential vector of chikungunya virus. Pathog. Glob. Health 112, 107–114.
    8. Dong, S. , Kantor, A.M. , Lin, J. , Passarelli, A.L. , Clem, R.J. , Franz, A.W.E.,2016. Infection pattern and transmission potential of chikungunya virus in two New World laboratory-adapted Aedes aegypti strains. Sci. Rep. 6, 24729.
    9. Eom, S. , Park, Y. , Kim, H. , Kim, Y. ,2014. Development of a high efficient dual Bt-Plus insecticide using a primary form of an entomopathogenic bacterium, Xenorhabdus nematophila. J. Microbiol. Biotechnol. 24, 507-521.
    10. Harbach, R.E. ,2007. The Culicidae (Diptera): a review of taxonomy, classification and phylogeny. Zootaxa 1668, 591–638.
    11. Jegal, S. , Jun, H. , Kim-Jeon, M.D. , Park, S.H. , Ahn, S.K. , Lee, J. , Gong, Y.W. , Joo, K. , Kwon, M.J. , Roh, J.Y. , Lee, W.G. , Lee, W. , Bahk, Y.Y. , Kim, T.S. ,2019. Three-year surveillance of culicine mosquitoes (Diptera: Culicidae) for flavivirus infections in Incheon Metropolitan City and Hwaseong-si of Gyeonggi-do Province, Republic of Korea. Acta Trop. 202, 105258.
    12. Jeong, Y.S. , Lee, D.K. ,2003. Prevalence and seasonal abundance of the dominant mosquito species in a large march near coast of Ulsan. Korean J. Appl. Entomol. 42, 125-132.
    13. Jung, S. , Kim, Y. ,2006. Synergistic effect of Xenorhabdus nematophila K1 and Bacillus thuringiensis subsp. aizawai against Spodoptera exigua (Lepidoptera: Noctuidae). Biol. Control 39, 201-209.
    14. Kang, S.H. , Jang, S.A. , Han, J.B. , Seo, D.K. , Song, C.H. , Kim, M.K. , Kim, Y.L. , Choi, S.H. , Kim, I.K. , Kim, G.H. ,2005. Comparative efficacy of mosquito repellents against Aedes albopictus (Diptera: Culicidae). Korean J. Appl. Entomol. 44, 243-249.
    15. Kil, M.R. , Kim, D.A. , Paek, S.K. , Kim, J.S. , Choi, S.Y. , Jin, D.Y. , Yu, Y.N. ,2008. Characterization of Bacillus thuringiensis subsp. tohokuensis CAB167 isolate against mosquito larva. Korean J. Appl. Entomol. 47, 457-465.
    16. Kim, E. , Kim, Y. ,2014. A report on mixed occurrence of tobacco whitefly (Bemisia tabaci) biotypes B and Q in Oriental melon farms in Kyungpook province, Korea. Korean J. Appl. Entomol. 53, 465-472.
    17. Kim, H.C. , Lee, K.W. , Richards, R.S. , Schleich, S.S. , Herman, W.E. , Klein, T.A. ,2003. Seasonal prevalence of mosquitoes collected from light traps in Korea (1999-2000). Korean J. Entomol. 33, 9-16.
    18. Kim, Y.K. , Lee, C.M. , Lee, J.B. , Bae, S.B. ,2012. Seasonal prevalence of mosquitoes and ecological characteristics of Anopheline larval occurrence in Gimpo, Gyeonggi Province, Republic of Korea. Korean J. Appl. Entomol. 51, 305-312.
    19. Kim, Y. , Stanley, D. , Ahmed, S. , An, C. ,2018. Eicosanoidmediated immunity in insects. Dev. Comp. Immunol. 83, 130-143.
    20. King, J.G. ,2020. Developmental and comparative perspectives on mosquito immunity. Dev. Comp. Immunol. 103, 103458.
    21. King, J.G. , Hillyer, J.F. ,2012. Infection-induced interaction between the mosquito circulatory and immune systems. PloS Pathog. 8, e1003058.
    22. Kudom, A.A. ,2015. Larval ecology of Anopheles coluzzii in Cape Coast, Ghana: water quality, nature of habitat and implication for larval control. Malar. J. 14, 447.
    23. Kurucz, K. , Kiss, V. , Zana, B. , Jacab, F. , Kemenesi, G. ,2018. Filarial nematode (order: Spirurida) surveillance in urban habitats, in the city of Pécs (Hungary) Parasitol. Res. 117, 3355–3360.
    24. Kwon, H. , Arends, B.R. , Smith, R.C. ,2017. Late-phase immune responses limiting oocyst survival are independent of TEP1 function yet display strain specific differences in Anopheles gambiae. Parasites Vectors 10, 1–9.
    25. League, G.P. , Hillyer, J.F. ,2016. Functional integration of the circulatory, immune, and respiratory systems in mosquito larvae: pathogen killing in the hemocyte-rich tracheal tufts. BMC Biol. 14.
    26. Lee, H.I. ,2003. Taxonomic review and revised keys of the Korean mosquitoes (Diptera: Culicidae). Korean J. Entomol. 33, 39-52.
    27. Lee, K.W. , Gupta, R.K. , Wilde, J.A. ,1984. Collection of adult and larval mosquitoes in U.S. army compounds in the Republic of Korea during 1979-1983. Korean J. Parasitol. 22, 102-108.
    28. Lima, E.P. , Goulart, M.O. , Rolim Neto, M.L. ,2015. Meta-analysis of studies on chemical, physical and biological agents in the control of Aedes aegypti. BMC Public Health 15, 858.
    29. Luplertlop, N. , Surasombatpattana, P. , Patramool, S. , Dumas, E. , Wasinpiyamongkol, L. , Saune, L. , Hamel, R. , Bernard, E. , Sereno, D. , Thomas, F. , Piquemal D , Yssel H , Briant L , Missé D. ,2011. Induction of a peptide with activity against a broad spectrum of pathogens in the Aedes aegypti salivary gland, following infection with dengue virus. PLoS Pathog. 7, e1001252.
    30. Marini, G. , Arnoldi, D. , Baldacchino, F. , Capelli, G. , Guzzetta, G. , Merler, S. , Montarsi, F. , Rizzoli, A. , Rosà, R. ,2019. First report of the influence of temperature on the bionomics and population dynamics of Aedes koreicus, a new invasive alien species in Europe. Parasit. Vectors 12, 524.
    31. Miles, J.A. ,1964. Some ecological aspects of the problem of arthropod-borne animal viruses in the Western Pacific and South-East Asia regions. Bull. World Health Organ. 30, 197–210.
    32. Montarsi, F. , Martini, S. , Dal Pont, M. , Delai, N. , Ferro Milone, N. , Mazzucato, M. , Soppelsa, F. , Cazzola, L. , Cazzin, S. , Ravagnan, S. , Ciocchetta, S. , Russo, F. , Capelli, G. ,2013. Distribution and habitat characterization of the recently introduced invasive mosquito Aedes koreicus [Hulecoeteomyia koreica], a new potential vector and pest in north-eastern Italy. Parasit. Vectors 6, 292.
    33. Montarsi, F. , Ciocchetta, S. , Devine, G. , Ravagnan, S. , Mutinelli, F. , Frangipane di Regalbono, A. , Otranto, D. , Capelli, G. ,2015. Development of Dirofilaria immitis within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe. Parasit. Vectors 8, 177.
    34. Moreno-García, M. , Vargas, V. , Ramírez-Bello, I. , Hernández- Martínez, G. , Lanz-Mendoza, H. ,2015. Bacterial exposure at the larval stage induced sexual immune dimorphism and priming in adult Aedes aegypti mosquitoes. PLoS One 10, e0133240.
    35. Pakpour, N. , Camp, L. , Smithers, H.M. , Wang, B. , Tu, Z. , Nadler, S.A. , Luckhart, S. ,2013. Protein kinase C-dependent signaling controls the midgut epithelial barrier to malaria parasite infection in anopheline mosquitoes. PLoS One 8, e76535.
    36. Park, Y. ,2015. Entomopathogenic bacterium, Xenorhabdus nematophila and Photorhabdus luminescens, enhances Bacillus thuringiensis Cry4Ba toxicity against yellow fever mosquito, Aedes aegypti (Diptera: Culicidae). J. Asia Pac. Entomol. 18, 459-463.
    37. Park, Y. , Kim, Y. , Yi, Y. ,1999. Identification and characterization of a symbiotic bacterium associated Steinernema carpocapsae in Korea. J. Asia Pac. Entomol. 2, 105-111.
    38. Park, Y. , Jung, J. , Kim, Y. ,2016. A mixture of Bacillus thuringiensis subsp. israelensis with Xenorhabdus nematophilacultured broth enhances toxicity against mosquitoes Aedes albopictus and Culex pipiens pallens. J. Econ. Entomol. 109, 1086-1093.
    39. Sadekuzzaman, M.D. , Kim, Y. ,2017. Specific inhibition of Xenorhabdus hominickii, an entomopathogenic bacterium, against different types of host insect phospholipase A2. J. Invertebr. Pathol. 149, 97-105.
    40. SAS Institute Inc.,1989. SAS/STAT User’s Guide, release 6.03 Ed. SAS Institute, Cary, NC.
    41. Seo, S. , Kim, Y. ,2011. Development of “Bt-Plus” biopesticide using entomopathogenic bacteria (Xenorhabdus nematophila, Photorhabdus temperata ssp. temperata) metabolites. Korean J. Appl. Entomol. 50, 171–178.
    42. Seo, M.J. , Gil, Y.J. , Kim, T.H. , Kim, H.J. , Youn, Y.N. , Yu, Y.M. ,2010. Control effects against mosquitoes larva of Bacillus thuringiensis subsp. israelensis CAB199 isolate according to different formulations. Korean J. Appl. Entomol. 49, 151-158.
    43. Seo, S. , Lee, S. , Hong, Y. , Kim, Y. ,2012. Phospholipase A2 inhibitors synthesized by two entomopathogenic bacteria, Xenorhabdus nematophila and Photorhabdus temperata subsp. temperata. Appl. Environ. Microbiol. 78, 3816–3823.
    44. Sim, S. , Ramirez, J.L. , Dimopoulos, G. ,2012. Dengue virus infection of the Aedes aegypti salivary gland and chemosensory apparatus induces genes that modulate infection and bloodfeeding behavior. PLoS Pathog. 8, e1002631.
    45. Stanley, D. , Kim Y. 2019. Prostaglandins and other eicosanoids in insects: biosynthesis and biological actions. Front. Physiol. 9, 1927.
    46. Tamura, K. , Stecher, G. , Peterson, D. , Filipski, A. , Kumar, S. ,2013. MEGA6: molecular evolutionary genetics analysis, version 6.0. Mol. Biol. Evol. 30, 2725-2729.
    47. Wang, Z.Q. , Perumaisamy, H. , Wang, M. , Shu, S. , Ahn, Y.J. ,2016. Larvicidal activity of Magnolia denudata seed hydrodistillate constituents and related compounds and liquid formulations towards two susceptible and two wild mosquito species. Pest Manag. Sci. 72, 897-906.
    48. Whitfield, J. ,2002. Portrait of a serial killer: a roundup of the history and biology of the malaria parasite. Nature
    49. Yeom, Y.S. ,2017. Current status and outlook of mosquito-borne diseases in Korea. J. Korean Med. Assoc. 60, 468-474.
    50. Yu, H.S. , Kim, H.C. ,1989. Integrated control of vector mosquitoes with native fishes (Aplocheilus and Aphyocypris) and Bacillus thuringiensis (H-14) in natural rice fields of Korea. Korean J. Appl. Entomol. 28, 167-174.