Gracillariidae, one of the important and huge groups of microlepidoptera, include about 2,000 species in the world, and most of them are leaf miners at larval stage (De Prins and De Prins, 2006-2018). There are three subfamilies belonging to Gracillariidae and they show distinction in the resting posture at adult stage: most genera of Gracillariinae pose with forepart of body raised steeply while those of Lithocollectinae and Phyllocnistinae pose body parallel to the surface, but some of Lithocollectinae rest with head lowered (Davis and Robinson, 1999). In Lithocollectinae, 10 genera and 508 species, including ChrysasterKumata, 1961, and 870 species of host plants have been reported (De Prins and De Prins, 2006-2018).

In the genus Chrysaster, only two species had been known: C. ostensackenella (Fitch, 1859), from North America, and C. hagicolaKumata, 1961, from East Asia including Korea. Recently, both species were reported from China (Bai et al., 2015;Liu et al., 2015), which is surprising as C. ostensackenella is a New World species that had never been reported from the Old World. While C. ostensackenella and C. hagicola are known to feed on some species of Robinia (Fabales: Fabaceae) and Lespedeza (Fabales: Fabaceae), respectively, Liu et al. (2015) also added Campylotropis macrocarpa (Fabales: Fabaceae) as a host plant of C. hagicola.

Here we report that, in addition to C. hagicola, C. ostensackenella is now found in Korea as well. Diagnostic characteristics and a brief description of C. ostensackenella, photographs of the larva and its mine, adult, and genitalia of both sexes are given. In addition, COI barcode sequences of both species are also provided for further molecular phylogenetic studies.

Materials and Methods

Larvae and adults of C. ostensackenella were collected from black locust trees, R. pseudoacacia in the day time and at night using UV black light. For laboratory rearing, each larva was kept in a Petri dish (Ø55 mm × 15 mm) with a leaf of a host species, R. pseudoacacia, until emergence.

Genitalia were dissected in a series of ethanol (from 50% to over 95%), stained with chlorazol black and mercurochrome, and slide-mounted in Euparal.

To obtain its COI barcode sequences, genomic DNA was extracted using the Genomic DNA Prep kit (SolGent Co., Ltd., Korea) and PCR amplification was conducted using 2X h-Taq PCR Pre-Mix (SolGent Co., Ltd., Korea). The primer set (LCO-1490 and HCO-2198) followed Folmer et al. (1994), with 35 cycles (95℃ 30 s, 50℃ for 40 s, and 72℃ for 45 s). For each PCR amplification condition, pre-denaturation step at 95℃ for 15 min before the 1st cycle and final polymerization step at 72℃ for 5 min right after the 35th cycle were added. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The COI barcode sequences obtained were confirmed its specific identity by comparing sequences of the same species on NCBI (https://www.ncbi. nlm.nih.gov).

Abbreviations of the provinces in Korea used for the collected material are as follows: GG, Gyeonggi province; CB, Chungbuk province; JN, Jeonnam province.

Systematic accounts

Genus ChrysasterKumata, 1961

ChrysasterKumata, 1961. Ins. Matsum. 24 (1): 52-56. Type species: Chrysaster hagicolaKumata, 1961. Type locality: Hokkaido, Japan.

Chrysaster ostensackenella (Fitch, 1859) 아까시나무가는나방 (신칭) (Figs. 1, 2)

Argyromiges ostensackenellaFitch, 1859. Rept. Ins. N. Y., v, 338. TL: New York, U.S.A.

Lithocolletis ornatellaChambers, 1871. Can. Ent., iii, 161-163.

Lithocolletis ostensackenellaChambers, 1871. Can. Ent., iii, 183.

Diagnosis. This species can be easily distinguished from C. hagicola by the following characteristics: tuft on head, blackish, not gold ocherous; saccus distally widened, truncated, and slightly concave (Kumata et al., 1983); and a short, silverywhite, median longitudinal streak near base of forewing absent (Kumata, 1961). In C. hagicola, head tuft is gold ocherous, distal end of saccus is not as much widened as in C. ostensackenella, rather slightly convex, and a short, silverwhite, median longitudinal streak near base of forewing is usually present.

Head. Head with short blackish tuft; antenna dark brown, as long as forewing.

Thorax. Wingspan 4-6 mm (n = 20). Thorax covered with metallic gold-brown scales. Forewing ground color orange, shiny, slightly darker basally, silvery white basally; four transverse fasciae silvery white outwardly, black inwardly; post-median and sub-terminal fasciae broken near middle. Termen black.

Abdomen. Abdomen metallic, dark brownish grey (Fig. 1B).

Male genitalia (Fig. 1B and C). Ventro-distal projection of valva pointed more ventrally than distally, only slightly longer than the mid-distal projection of valva. Aedeagus near straight, not angled around middle. See Kumata et al. (1983) and Liu et al. (2015) for detailed characteristics distinguishing between C. ostensackenella and C. hagicola.

Female genitalia (Fig. 1D). Corpus bursae membranous without signum. Ductus bursae very short with a sclerotized antrum. Anterior and posterior apophyses similar in length. No prominent characters to distinguish the two species. See Liu et al. (2015).

Material examined. Adults: 9 ♂, 11 ♀, Chungbuk Univ., Gaesin-dong, Cheongju-si, CB, Korea, N36°37'43.39" E127° 27'02.71", Alt. 67 m, 29 vi 2017 (SK Kim & JM Koo), gen. slide no. KJM0017 (♂), KJM0096 (♂), KJM0097 (♀), KJM0098 (♀); 5 larvae, Bundang-gu, Seongnam-si, GG, Korea, N37°23'33.76" E127°05'30.63", Alt. 93 m, 13 vii 2017 (JM Koo and HE Lee); 4 larvae, Singi-dong, Yeosu-si, JN, Korea, N34°45'23.30" E127°40'43.45", Alt. 86 m, 7 vii 2017 (HE Lee); 7 larvae, Seongbuk-gu, Seoul, Korea, N37°35'08.79" E127°01'37.91", Alt. 45 m, 27 vii 2017 (JM Koo).

Host plant. Fabaceae: Robinia hispida, R. pseudoacacia, R. neomexicana, R. viscosa (Chambers, 1871, 1878;Braun, 1935;Liu et al., 2015).

Distribution. Korea (new record), China, Canada and U.S.A.

COI barcode sequence. We obtained COI barcode sequences from seven specimens and they were all 99% identical to the sequence (KX069358.1) of C. ostensackenella in NCBI. The COI barcode sequences of C. ostensackenella and C. hagicola showed 91-92% similarity in p-distance while the sequence similarity within-species showed 99-100%. P-distance of 8-9% is a considerable difference for a specific distinction. In addition, we sequenced the COI barcodes from two larval specimens of C. hagicola. Two representative sequences for each species are as follows:

C. ostensackenella 

AACATTATATTTTATTTTTGGAATCTGATCAGGAATAGT AGGATCCTCTTTAAGAATTTTAATTCGTGTTGAATTAGG AACTCCAGGATCAGTAATTGGAGATGATCAAATTTATA ATACTATTGTAACAGCTCATGCATTTATTATAATTTTTT TTATAGTTATACCTATTATAATTGGGGGATTTGGTAATT GATTAGTACCATTAATATTAGGTGCCCCAGATATAGCC TTTCCCCGTCTTAATAATATAAGATTCTGACTACTTCCC CCTTCTATTTTATTATTAATTTCCAGAAGAATTGTAGAA AGAGGAGCGGGAACTGGGTGAACTGTTTATCCCCCCCT ATCATCTAATATTGCTCATAGAGGAAGATCAGTAGATT TAGCCATTTTCTCCTTACATTTAGCAGGAATTTCATCTA TTTTAGGAGCTATTAATTTTATTACAACTATTATTAATA TACGAGCTAATGGGATAATATTTGATAAAATACCTTTA TTTGTCTGAGCAGTTGGTATTACTGCATTATTATTACTT TTATCCCTACCTGTATTAGCAGGAGCTATTACAATATTA TTAACAGATCGAAATATTAATACTTCTTTTTTTGATCCA GCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

C. hagicola 

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGT AGGAACTTCTTTAAGAATCTTAATTCGTGTTGAATTAGG AACCCCGGGTTCAATAATCGGAAATGATCAAATTTATA ATACTATTGTCACAGCTCATGCATTTATTATAATTTTTTT TATAGTTATACCTATTATAATTGGAGGATTCGGTAACTG ATTAGTTCCACTAATATTAGGGGCTCCAGATATAGCTTT CCCCCGCCTTAATAATATAAGATTTTGATTATTACCCCC TTCTATTTTATTATTAATTTCTAGAAGAATTGTAGAAAC AGGAGCAGGAACTGGATGAACTGTTTATCCTCCATTAT CATCTAATATTGCTCATAGAGGAAGATCAGTAGACTTA GCTATCTTTTCATTACATTTAGCAGGAATTTCATCTATT TTAGGGGCAATTAATTTTATCACAACTATTATTAATATA CGAACTAACGGAATATTATTTGACAAAATACCATTATT TGTTTGAGCAGTAGGAATTACTGCATTATTATTACTCTT ATCGTTACCTGTATTAGCGGGAGCTATTACAATATTATT AACAGATCGAAATCTTAATACTTCTTTTTTTGACCCGGC TGGAGGAGGAGATCCTATTTTATATCAACATTTATTC

Remarks. The larvae mine leaves of black locust and chew mesophyll of it (Fig. 2B and C;https://www.youtube.com/ watch?v=qqNLoy0cX7E&feature=youtu.be). On the upper side of the leaf, the mine looks like a circular yellowish blotch in early stage, and over time, it becomes irregular in shape. Sometimes, it occurs underside of the leaf. Pupation occurs inside the leaf mine (Braun, 1908) or outside the mine. In China, C. ostensackenella has four generations a year (Liu et al., 2015).

Discussion

Finding of C. ostensackenella in Korea means it is probably introduced from China. As they feed on false acacia, bee or honey business may be affected depending on how serious the damage is to the trees. In case of China, Liu et al. (2015) noted that, when infested, more than 80%, over 90% when seriously infested, of the leaflets of black locust trees were attacked and damaged in Yantai, Shandong Province, and emphasized that relevant control measures should be undertaken and intensive studies should be conducted to fully understand this invasive species.