Journal Search Engine

Download PDF Export Citation Metrics Korean Bibliography
ISSN : 1225-0171(Print)
ISSN : 2287-545X(Online)
Korean Journal of Applied Entomology Vol.57 No.1 pp.39-42
DOI : https://doi.org/10.5656/KSAE.2018.01.1.027

Genus Conwentzia (Neuroptera: Coniopterygidae: Coniopteryginae) New to Korea

Seulki Kim, Junmo Koo, Soowon Cho*
Department of Plant Medicine, Chungbuk National University, Cheongju 28644, Korea
Corresponding author: soowon@chungbuk.ac.kr
20170831 20180105 20180207

Abstract

Conwentzia is a newly recorded genus in Korea, based on C. pineticola. A brief description, photos of adult and male genitalia, and 16S rRNA and COI sequences of the species are provided.


가루풀잠자리과 미기록속 및 미기록종 Conwentzia pineticola (풀잠자리목: 가루풀잠자리아과)의 보고

김 슬기, 구 준모, 조 수원*
충북대학교 농업생명환경대학 식물의학과

초록

Conwentzia와 C. pineticola를 한국 미기록속 및 미기록종으로 보고한다. 본 종의 성충에 대한 간략한 기재와 성충 사진 및 생식기 사진과 함께, 16S rRNA 와 COI 염기서열을 제공한다.


    Coniopterygids or, more commonly, dustywings are the pygmies of the order Neuroptera, apparently because of their small size. Coniopterygidae is a family of about 560 described species in 23 genera (Sziráki, 2011). They feed on small sized arthropods such as mites, aphids and scale insects. This family is surely monophyletic, and the last major revisionary work was the monograph by Meinander (1972) on the world genera. Since then, there have been world catalogs of the species (Meinander, 1990; Sziráki, 2011).

    In Asia, both China and Japan have multiple species of Coniopterygidae described while only one species, Semidalis aleyrodiformis has been recorded from Korea (Lee et al., 2010). In this study, we collected another coniopterygid, Conwentzia pineticola, a species of the genus Conwentzia belonging to the subfamily Coniopteryginae. The genus and the species are both new to Korea. The genus Conwentzia includes about 14 species in the world (Sziráki, 2011). This group is one of the characteristic groups of the subfamily in that their hind wings are conspicuously reduced than those of other genera. Here we provide taxonomic information including a brief description, photos of adult and male genitalia, and COI and 16S rRNA sequences based on C. pineticola in Korea.

    Materials and Methods

    We used light trap for collecting and most of the samples were preserved in >95% ethanol. In viewing its characteristics, the sample was soaked in glycerol and examined through a stereo light microscope (Olympus SZX 16, Tokyo, Japan), often with an imaging facility. The specimens were examined and deposited in the insect collection room of the Department of Plant Medicine at Chungbuk National University, Cheongju, Korea.

    Genomic DNA was extracted using this DNeasy Tissue kit (Qiagen, Hilden, Germany) and PCR amplification was conducted using the primer sets following Folmer et al. (1994) and Haring and Aspöck (2004) with 35 cycles (95℃ 30 s, 50℃ for 40 s, and 72℃ for 45 s). For each PCR amplification condition, pre-denaturation at 95℃ 15 min and final polymerization at 72℃ for 5 min. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany).

    The COI barcode sequences and 16S rRNA sequences were aligned and compared using Geneious 5.59 (http://www. geneious.com, Kearse et al., 2012).

    The abbreviations used in the Material examined are CB for Chungbuk Province and CN for Chungnam Province.

    Systematic accounts

    Family Coniopterygidae Burmeister, 1839

    Subfamily Coniopteryginae Burmeister, 1839

    Tribe Conwentgini Enderlein, 1905

    Genus ConwentziaEnderlein, 1905

    ConwentziaEnderlein, 1905, Bericht des Westpreussischen Botanischen-Zoologischen Vereins 26/27: 10. Type species: Conwentzia pineticolaEnderlein, 1905.

    Diagnosis. Head capsule wider dorsoventrally than anteroposteriorly on lateral view. Frons unsclerotized between antennae but ventrally hardly sclerotized. Thorax with indistinct shoulder spots. Forewing about two and a half times as long as broad; membrane unspotted; some longitudinal veins covered with very short hairs; marginal fringe very short or absent. Hind wing significantly reduced, except C. barretti (Banks) with developed hind wings; venation of fully developed wing similar to forewing. Abdomen slightly sclerotized; wax glands present on most tergites and lateral sternites but absent from 8th segment in male and 6-7 tergites in female.

    Conwentzia pineticolaEnderlein, 1905 소나무뒷날개가루 풀잠자리(신칭) (Figs. 1-3)

    Conwentzia pineticolaEnderlein, 1905, Bericht des Westpreussischen Botanischen-Zoologischen Vereins 26/27: 10. Type locality: Germany, Berlin.

    Conwentzia hageniBanks, 1906: 82.

    Coniopteryx reticulata Tullgren, 1906: 14.

    Conwentzia angulata Navas, 1914: 16.

    Conwentzia axillata Navas, 1914: 16.

    Conwentzia cryptoneurusBagnall, 1915: 192.

    Description. Adult (Figs. 1, 2). Head capsule blackish; vertex with a small swelling above antennae; frons and vertex covered with short hairs; clypeus with long hairs. Eyes of male larger and more bulging than those of female. Antennae pale dark brown; antenna of male 32-36 segmented; scape and pedicel slightly swollen, a little bit longer than broad; flagellum about as broad as long basally, about one and a half times as long as broad apically. Flagellum thicker in male, about one and a half times as broad as in female. Thorax dark brown. Legs dark fuscous. Forewing greyish. Hind wing much more reduced than forewing in size; length of forewing 3.5-3.9 mm; length of hind wing 0.8-1.3 mm.

    Male genitalia (Fig. 3). Outer process of ectoprocts tapering towards apex. Abdomen, abdominal styli tip tapered, slightly hooked; 9th sternite smaller than 10th on ventral view. tips of paramere postero-dorsally diverged, tips sharp.

    Material examined. 1 male: Chungbuk National University, Gaeshin-dong, Cheongju-si, CB, Jun. 6, 2008, coll. S.K. Kim; 1 female: ditto, CB, Sep. 29, 2013, coll. S.K. Kim; 1 male: Chujeong-ri, Nangseong-myeon, Cheongwon-gun, CB, May 31, 2014, coll. S.K. Kim; 1 female: Uam-san[Mt], Sangdang-gu, Cheongju-si, CB, May 30, 2014, coll. S.K. Kim; 2 females: Bangsan-ri, Daesul-myeon, Yesan-gun, CN, Apr. 22, 2015, coll. S.K. Kim; 1 female: Worak-san[Mt], Worak-ri, Deoksan-myeon, Jecheon-si, CB, May 21, 2015, coll. S.K. Kim.

    Distribution.

    The species is widely distributed throughout the Ethiopian, Oriental and Australian regions, and also occurring in the southern parts of the Palaearctic region, including Korea (Central).

    COI and 16S rDNA sequences

    The following mtDNA sequences are obtained from the sample we collected. In addition to the COI barcode sequence, we provide the 16S rDNA sequence because recent molecular works on Coniopterygidae often applied 16S rDNA either alone or with other genes (Grimaldi et al., 2013; Wang and Liu, 2007; Winterton et al., 2010).

    COI region (658 bp)

    AGTTTTATATTTTTTATTCGGAATTTGAGCAGCTA TATTAGGAACATCCCTTAGAATTTTAATTCGAGCCG AATTAGGAAACCCGGGATCTTTAATTGGAGATGATC AAATTTATAATGTAATTGTGACAGCTCATGCTTTTAT TATAATTTTTTTTGCTGTTATACCAATTTTAATTGGG GGGTTTGGAAATTGATTAGTTCCCTTAATGCTAGGA GCCCCCGATATAGCATTTCCTCGTATAAATAATATA AGATTTTGATTATTACCCCCCTCTCTAACATTATTAT TAATAAGTTCATTAGTAGAAAGAGGATCAGGAACA GGATGAACAGTTTATCCTCCTTTATCCTCTAATATTG CCCATTCTGGAAGTTCAGTTGATTTAGCTATTTTTAG ATTACATTTAGCAGGGGCTTCATCAATTTTAGGAGC TATTAATTTTATTACAACTGTAATTAATATACGACCC ATAGGAATAACTTTAGAGCGAATACCCCTATTTGTAT GGTCTGTTGTAATTACCGCTTTTTTATTACTTTTATCT TTACCGGTATTGGCCGGAGCAATTACTATATTATTAA CAGATCGAAATTTTAATACTTCTTTTTTTGACCCCGC CGGAGGGGGGGATCCAATTTTATATCAACATTTATTT

    16S rRNA region (506 bp)

    TTTTTGAGTATAATTTAAAGTCTGACCTGCCCACT GAATTTATTTAAAGGGCCGCAGTATTTTGACTGTGCT AAGGTAGCATAATCACTTGTTTTTTAATTGAAAACT AGAATGAATGGTTTGATAAAAAATAAGCTGTCTCTA TTTAAAAATTATAAAAATTTAAAATTTTAGTTAAAA TGCTAAAATTTATATAAAAGACGAGAAGACCCCATA GATCTTTATAATTGTTTTTAATAAAATTATTTATTTTT AAAAATATTTTTACAAAAATAATTATTGAATTGGGG CGATTAAAAAATTTAATAAACTTTTTTATATTTTAAA TACTAATTAGTATAAATTTGATCCATTATTATGATTA TTTGATTAAGTTACCTTGGGGATAACAGCGTAATTTT TTTGGGGAGTTCATATCTATAAAAAAGATTACGACC TCGATGTTGAATTAAAGTTAATTTTAGGAGTAGAAA TTTAAAATTTTAGTCTGTTCGACTATTTAACTT

    Acknowledgements

    We thank Ms. E. J. Lim (Department of Plant Medicine, Chungbuk National University, Cheongju, Korea) and Mr. S. K. Lee (Agricultural Research and Extension Services, Cheongju, Korea) for their help in collecting coniopterygids. This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2015R1D1A1 A1060266).

    KSAE-57-39_F1.gif

    Lateral view of the adult of Conwentzia pineticola.

    KSAE-57-39_F2.gif

    Wings of Conwentzia pineticola. Scale bar = 1 mm.

    KSAE-57-39_F3.gif

    Caudal view of the male genitalia of Conwentzia pineticola. Scale bar = 0.1 mm.

    Reference

    1. BagnallR.S. (1915) Conwentzia cryptoneuris sp. n., a neuropteron (Coniopterygidae) new to the British fauna. , Ent. Mon. Mag., Vol.51 ; pp.192-193
    2. BanksN. (1906) A revision of the Nearctic Coniopterygidae. , Proc. Entomol. Soc. Wash., Vol.8 ; pp.77-86
    3. EnderleinG. (1905) Conwentzia pineticola nov. gen. nov. spec. eine neue Neuroptere aus Westpreussen. , Bericht des Westpreussischen Botanischen-Zoologischen Vereins, ; pp.10-12
    4. EnderleinG. (1906) Monographie der Coniopterygiden. , Zoologische Jahrbücher (Abteilung für Systematik, Geographie und Biologie), Vol.23 ; pp.173-242
    5. EnderleinG. (1908) Family Coniopterygidae. Neuroptera. , Genera Insectorum, Vol.67 ; pp.1-18
    6. GrimaldiD. EngelM.S. NascimbeneP.C. SinghH. (2013) Coniopterygidae (Neuroptera: Aleuropteryginae) in amber from the Eocene of India and the Miocene of Hispaniola. , Am. Mus. Novit., Vol.3770 ; pp.20-39
    7. HaringE. AspöckU. (2004) Phylogeny of the Neuropterida: a first molecular approach. , Syst. Entomol., Vol.29 ; pp.415-430
    8. KearseM. MoirR. WilsonA. Stones-HavasS. CheungM. SturrockS. BuxtonS. CooperA. MarkowitzS. DuranC. ThiererT. AshtonB. MentjiesP. DrummondA. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. , Bioinf., Vol.28 ; pp.1647-1649
    9. LeeS.K. KimS.K. SohnJ.C. ChoS. (2010) Introduction to the family Coniopterygidae (Neuroptera) with Semidalis aleyrodiformis (Stephens) from Korean Peninsula. , Korean J. Appl. Entomol., Vol.49 ; pp.5-9
    10. LiuZ.Q. YangC.K. , HuangF.S. (2002) Forest Insects of Hainan., Science Press, ; pp.302-304
    11. MeinanderM. (1972) A revision of the family Coniopterygidae (Planipennia). , Acta Zool. Fenn., Vol.136 ; pp.1-357
    12. MeinanderM. (1990) The Coniopterygidae (Neuroptera, Planipennia): a check-list of the species of the world, descriptions of new species and other new data. , Acta Zool. Fenn., Vol.189 ; pp.1-95
    13. NavA sL. (1914) New Neuroptera from the United States. , Bull. Brooklyn Entomol. Soc., Vol.9 ; pp.13-20
    14. SzirákiG. (2011) Coniopterygidae of the world: annotated check-list and identification keys for living species, species groups, and supra-specific taxa of the family., LAP [Lambert Academic Publishing],
    15. TullgrenA. (1906) Zur Kenntnis schwedischer Coniopterygiden. , Ark. Zool., Vol.3 ; pp.1-15
    16. WangW-Q. LiuZ-Q. (2007) Molecular phylogenetic relationship of the Coniopterygidae from China based on 16S rRNA sequences. , Dong Wu Fen Lei Xue Bao, Vol.32 ; pp.851-855
    17. WintertonS.L. HardyN.B. WiegmannB.M. (2010) On wings of lace: phylogeny and Bayesian divergence time estimates of Neuropterida (Insecta) based on morphological and molecular data. , Syst. Entomol., Vol.35 ; pp.349-378

    Vol. 40 No. 4 (2022.12)

    Journal Abbreviation Korean J. Appl. Entomol.
    Frequency Quarterly
    Doi Prefix 10.5656/KSAE
    Year of Launching 1962
    Publisher Korean Society of Applied Entomology
    Indexed/Tracked/Covered By